Sentence examples for minor sequence variants from inspiring English sources

Drawbacks intrinsic to conventional Sanger sequencing are the variable subjective interpretations of sequencing results, limited sensitivity for minor sequence variants, and cost.

The significance of minor sequence variants, which exist within individuals in surveillance cohort but below the detection threshold of conventional techniques, remains to be explored.

Taken together, our data demonstrate the feasibility and utility of harnessing deep sequencing platforms to comprehensively assess viral diversity, quantify minor sequence variants, and provide insight into the mechanisms of viral escape from novel CCR5 antagonists.

Among the 17 major sequence groups of ospC, 2 minor sequence variants of major-group allele B were geographically distinct and thereby named B1 in North America and B2 in Europe.

The great majority of wMel annotated repeat sequences longer than 200 nt are associated with mobile elements (Wu et al. 2004), and it seems functionally unlikely that minor sequence variants in one or more copies of these genes might cause pathogenesis.

Although human cells express minor sequence variants of the U1 snRNA (Kyriakopoulou et al, 2006), direct RNA sequencing of 3′-end labelled TAF15-associated U1 snRNA has revealed a nucleotide sequence identical to the Gly41 Gly164 3′-terminal portion of the most abundant U1A sequence variant of U1 snRNA (data not shown).

When we performed a blastn search of GenBank using a text string that included the minor sequence variant at both positions (ATTCTTCAAATATCTACTCATT), three of the 20 fully matching human results represented a NUMT on Chromosome 13.

Evaluation of the initial contigs by homology comparisons of the sequences with themselves indicated under-contigging, with highly similar sequences probably remaining from allelic variants (from heterozygous source DNA), splice variants, and minor sequencing variants.

Quantitative deep sequencing of plasma samples from subjects failing a CCR5 antagonist-containing regimen provided orders of magnitude greater coverage than previously possible and revealed that minor V3 loop sequence variants have significant clinical implications in chronic HIV-1 infection.

This data set shows all the related miRNA families and minor sequence or nucleotide variants.

Of these twelve variants, ten have been previously reported as polymorphisms (sequence variants with minor allele frequency greater or equal to 1%) in the dbSNP database [ 16].