Sentence examples for minimal targets from inspiring English sources

Evaluations of EDI need to include such analysis to inform setting minimal targets for effective implementation.

Nor will the package currently being discussed achieve the minimal target of centrist deficit hawks (myself among them), that of stabilizing the rate in which the national debt is growing in relation to the economy.

The minimal target should be to get ready for manufacturing (including securing a supplier).

Given a required accuracy for spray deposits, the minimal target area can be derived.

Only the total skeletal retention of [177Lu]DOTA MBP 2 increased to 64.5 ± 1.5 %ID but showed at the same time the minimal target to soft-tissue ratio.

This target has been designed to have minimal target density fluctuations under the heat load of a 20μA CW 854.3 MeV electron beam without rastering the electron beam.

The small size, minimal targeting constraints, and modular regulation of Cas13d effectors further expands the CRISPR toolkit for RNA manipulation and detection.

In Experiments 2 and 3, we held contrast constant and we varied size, in order to establish the minimal target that could be discriminated for each of the two classes of cone.

These minimal targeting and anchor signals allow localization of luciferase on the outer side of the plasma membrane.

A ΦC31/att β-galactosidase reporter ES cell line was constructed similarly to the above, except that the stop cassette was flanked by the minimal target DNA recognition sites, the 35 bp attB (GGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCG) and the 39 bp attP (CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG) [10].

In support of this conclusion, experiments in which ITC and IVC assays were performed simultaneously in tumor-bearing mice showed that within the same animal, minimal target lysis occurred in tumors at day 2 post-T cell transfer even while high levels of target lysis were observed in dLNs and spleens (LAN, unpublished observations).