Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
OCHA describes different types of interactions between humanitarian and military actors in conflict zones, ranging from minimal interaction to collaboration [ 17].
Similar(59)
Boiling the concept of minimal interaction down to purest form, each level requires nothing more than a single screen tap, and yet Splode still demonstrates considerable cunning.
The collection of tools is designed to require minimal user interaction to produce cortical representations.
We address two problems associated with preference elicitation: computing a best feasible solution when the user's utilities are imprecisely specified; and developing useful elicitation procedures that reduce utility uncertainty, with minimal user interaction, to a point where (approximately) optimal decisions can be made.
The reported minimal aptamers participate in Interactions that are distinct from those of their parent aptamers, thereby permitting the linking of a minimal aptamer target interaction to a dissociation constant topic that is distinct from that of its parent.
For example, in some cases there was a sense of a one-way process where clinicians conducted numerous assessments and conveyed much information to parents but with minimal interaction with regard to decision-making.
IP/IB results for positive (WT) and negative (neo) control cell lines demonstrate the anticipated interaction of ICAM-2, α-actinin and actin compared to minimal interaction of α-actinin and actin when ICAM-2 was not expressed.
In it you sit and watch a set of businesses make money, first by tapping on them to begin production, but soon enough without even this minimal interaction as you hire managers to tap for you.
This could be due to the minimal interaction volume of the 2-nm-thickness sample.
Among them, 3H, 14C, 36Cl, 99Tc, and 129I presumably have large migration potential due to a minimal interaction with the subsurface media.
The 366 amino acid coding region of MOMP (without the signal sequence) was fused to the minimal interaction domain (mINT) derived from VPARP (amino acids 1563 1724) by PCR ligation using the following primers: MOMP-mINT reverse- TCCTGCCAGTGTTGTGTGCAGAAACGGAACTGAGCATTTAC; MOMP-mINT forward- GTAAATGCTCAGTTCCGTTTCTGCACACAACACTGGCAGGA; mINT reverse- GGGCTCGAGTTAGCCTTGACTGTAATGGAG.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com