Suggestions(5)
Exact(1)
Moreover, configuration with a minimal interaction from the user and security on the communication should be established.
Similar(58)
The 366 amino acid coding region of MOMP (without the signal sequence) was fused to the minimal interaction domain (mINT) derived from VPARP (amino acids 1563 1724) by PCR ligation using the following primers: MOMP-mINT reverse- TCCTGCCAGTGTTGTGTGCAGAAACGGAACTGAGCATTTAC; MOMP-mINT forward- GTAAATGCTCAGTTCCGTTTCTGCACACAACACTGGCAGGA; mINT reverse- GGGCTCGAGTTAGCCTTGACTGTAATGGAG.
OCHA describes different types of interactions between humanitarian and military actors in conflict zones, ranging from minimal interaction to collaboration [ 17].
The family says it had minimal interaction with police officers before moving to North Carolina from New York City in October.
Her team therefore worked with a mixture of pet dogs, dogs from animal shelters that had had minimal interaction with people, and wolves raised by humans.
Here, with minimal interaction with the outside world, he honed his paranoid ideology.
I puzzled over the low lighting, appreciated the minimal interaction and eventually fell asleep.
Lincoln's schedule, he said, had been tailored to meet the needs of teachers, not students, and there was minimal interaction between the two.
Boiling the concept of minimal interaction down to purest form, each level requires nothing more than a single screen tap, and yet Splode still demonstrates considerable cunning.
But Mr. Barak, like his mentor, Mr. Rabin, was always skeptical of this cooperative vision, and saw the recent events as vindicating his preference for minimal interaction.
This could be due to the minimal interaction volume of the 2-nm-thickness sample.
More suggestions(2)
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com