Your English writing platform
Discover LudwigExact(49)
Using EMR data collected in the Nanshan Mine of the Hegang mining area, we verified that the analytical result were consistent with actual situations.
This system underwent an industrial test on working face 8105 in the Tashan Mine of the Datong coal mining district, and the annual output of this face reached 10.85 million tons.
MinE without membrane targeting sequence (MinE Δ3 8)) was generated by deleting the coding sequence for aminoacids 3 8 of MinE of the overexpression plasmid for MinE (Loose et al., 2008) using a 'GeneArt, Seamless Cloning and Assembly Enzyme Mix' (Invitrogen, Life Technologies, Carlsbad, CA) and primers TTCCGCGATGCGAATTCGGATCCGCGACC and AATTCGCATCGCGGAAGAAAAACACAGCCAACA to obtain pET28a-MinE Δ3 8 pET28a-MinE Δ3 8
Multinational mining company Rio Tinto, as part of its "Mine of the Future" initiative, has completely automated its trucks at a site in Australia, and Canadian oil company Suncor Energy announced this month that it is following suit.
She allays fears (mine) of the plane running out of fuel.
I talk of her life and of mine, of the joys and regrets.
Similar(11)
The four main key focus areas of the mine-of-the-future have been identified as operating practices and technology; talent and leadership; partnership with key stakeholders; and governance.
A significant question that arises is the preparedness of mining engineering education in Africa to address the vision of the mine-of-the-future in relation to these four focus areas.
Mine waste calcine was also collected from Hg mines of the Terlingua district, Texas.
Cities are gradually becoming the mines of the future, while traditional mines dry up.
This season, their mining of the traditions of Sicily reached new levels of tenuous.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com