Sentence examples for mid was generated from inspiring English sources
The MID, ES, and SEM were thought to complement each other well; the MID was generated by an anchor based method, whereas ES and SEM are distribution based methods.
Plas-mid pPCTcPFR2 was generated as follows: amplification of the TcPFR2 gene was performed using Trypanosoma cruzi genomic DNA (kind gift of Cécile Gallet and Philippe Grellier, MNHN) and the two primers TcPFR2H (GAGTCTAAGCTTATGAGCTACAAGGAGGCATC) and TcPFR2ER (GCGTGGAATTCTTACTGTGTGATCTGCTGCAC).
17 The broadband mid-IR pulse was generated by optical parametric amplification (OPA) and difference frequency generation (DFG) from a part of the output of a Ti:sapphire regenerative amplifier (center wavelength: 800 nm; pulse duration: 120 fs; repetition rate: 1 kHz).
The incision was closed, and a closed mid-diaphyseal fracture was generated using a three-point bending apparatus, as described by Bonnarens and Einhorn [ 21].
With this in mind, Crenezumab (hIgG4, mid-domain epitope) was generated with a human IgG4 constant region to modify Fc effector function and reduce vascular side effects [ 1].
The conditionally IMEC line KIM-2 that was generated from the mid-pregnant gland of the BLG-tsTAg transgenic mouse, and the spontaneously immortalized HC11 line also derived from a mid-pregnant mouse, both have the capacity to functionally differentiate in response to lactogenic hormones in vitro [ 23, 25].
A random sample stratified on gender (n = 100, 33% women) was generated from officers in a mid-sized urban department.
Mid-surface models are widely used in engineering analysis to simplify the analysis of thin-walled parts, but it can be difficult to ensure that the mid-surface model is representative of the solid part from which it was generated.
By 1968, the chain had reached out of the mid-South and was generating more than $40 million a year in sales.
These tonalities which occupied a mid-crustal position were generated by partial melting of lower crust.
Contrary to the low latitude, the toroidal field in mid and high latitudes is generated by the process of flow advection.
