Sentence examples for mice were plotted from inspiring English sources

Exact(8)

FOS+ and FOS- DG, CA1, and VIP neurons from both HC and NE-exposed mice were plotted using activity-dependent genes identified in any of the three cell types.

For survival assay, the survival of mice in each group was recorded, and the ratios of surviving mice were plotted.

The relationship between the percentage of cells remaining in the subiculum following the lesion (cell count% contralateral side) and Aβ/C99 pathology in subiculum, CA1 and RSG (% Aβ immunoreactivity) in Tg + Ibo mice were plotted.

RARRES3 short hairpins sequence: sh#1: CCGGCCCGCTGTAAACAGGTGGAAACTCGAGTTTCCACCTGTTTACAGCGGGTTTTTG sh#2: CCGGGCGCTTGGAATCCTGGTTGTTCTCGAGAACAACCAGGATTCCAAGCGCTTTTTG Control short hairpin: ShControl: CCGGCATCGACAAGACTGCTAACCACTCGAGTGGTTAGCAGTCTTGTCGATGTTTTTG Metastasis-free survival curves of mice were plotted using Kaplan Meier estimates and compared using the log-rank test.

When the log-transformed (base 2) normalized intensities of gene expression levels in HTLV-I-Tg mice were plotted against those of IL-1Ra-KO mice, we observed a high degree of correlation (correlation coefficient, r = 0.77), indicating that the expression of many genes changed in both models.

To compare how the gut microbiota affects WAT gene expression in mice fed lard or fish oil, differences in expression level between CONV-R and GF mice were plotted for significantly regulated genes, with values for mice fed fish oil on the x axis and values for mice fed lard on the y axis.

Show more...

Similar(52)

Data from single mice are plotted.

(A ) Scratching behavior in WT and Slo2 dKO mice is plotted following injection of 1 mg HA. (B ) Scratching behavior after 0.3 mg HA is compared.

For tumor volume measurements, the average tumor volume from five mice was plotted over time and analyzed using a two-tailed unpaired Student's t test.

Kaplan Meier curve of overall survival of mice was plotted and analyzed by Graphpad Prism 6 software (Graphpad software, La Jolla, CA, USA).

With the threshold ranging from 1 to −1 in 0.02 increments, the fraction of Δ gap startle ratios above threshold in 4 days noise-exposed mice was plotted against the fraction of Δ gap startle ratios above threshold in 4 days sham-exposed mice.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: