Sentence examples for mice were facilitated from inspiring English sources

It is possible that hippocampal lesioned mice were facilitated because they failed to encode the incidental information as rapidly as controls.

It was found that hippocampal lesioned mice were facilitated at learning the discriminations, but they were sensitive to changes in spatial information in a manner that was similar to control mice.

Genotyping of transgenic mice was facilitated by the polymerase chain reaction (PCR) using the primers, 5' AGAAGGAGGGTGACCTGATAG and 5' ACCAGGTTGCTGTTCCTCT.

Restoration of cardiac form and function in post-infarct mIGF-1 transgenic mice was facilitated by modulation of the inflammatory response [30].

16 It is possible that effects of the herbal formula B307 in ameliorating cardiac failure in R6/2 HD mice may be facilitated through other protective mechanisms.

Second, the milder phenotype observed in Scn1afl/fl, PV-Cre-TG mice may be facilitated by the ameliorating effect of Nav1.1 deletion in PV-positive excitatory neurons.

Breaking the tolerance in MRL/lpr mice might also be facilitated by a relative enhanced sensitivity of their DC for these immunogenic apoptotic MVs.

Treating rodents with IL-6 can impair measures of memory [ 59, 60], yet in knockout mice recall can be facilitated [ 61, 62]: the relationship of IL-6 to cognitive function may be linear or U-shaped [ 63].

Discovery of the mouse metabolic QTL was facilitated by characterizing nested introgression lines within a chromosome (Shao et al. 2008), the approach that also succeeded best in our study of C. elegans preference behavior.

"We were facilitating it".

The study of apoptosis in the mouse mammary gland has been facilitated by using a forced weaning protocol in which the suckling pups are removed when they are about 10 days old, at the peak of lactation and prior to a natural wean.