Sentence examples for mice two pairs from inspiring English sources

Exact(1)

For genotyping Cre/FoxM1flox/flox mice, two pairs of primers were used for PCR: Cre 5' (CCAGCTAAACATGCTTCATCGTC) and Cre 3' (CCTGATCCTGGCAATTTCGG); FoxM1 5' (TAGGAGATACACTGTTATAT) and FoxM1 3' (TGTGGGAAAATGCTTACAAAAG).

Similar(59)

For Western blotting, a total of eight mice (four pairs of WT and Mecp2−/y littermates) were sacrificed over the course of the study, at ages ranging from 3 to 6 weeks.

Briefly, the dorsal skin of each mouse (six pairs of WT and KO mice) was painted with TPA twice at an interval of 24 h (8.1 nmol in 100  μl acetone; Sigma-Aldrich) or with AFN (15 nmol in 100  μl acetone) applied topically.

Giant mouse lemurs have two pairs of mammae, one on the chest (pectoral) and one on the abdomen (abdominal).

The results from qPCR are displayed as relative expression levels in mutant mice, compared with matched WT littermates; the data are from two pairs of mice at the indicated times in lactation (Table 1).

In these two pairs of mice, the spleens of OGR1 KO mice appeared to be somewhat smaller than those of the FL mice, whereas the livers and hearts of the KO mice were somewhat larger than those of the FL mice.

A total of 16 arrays were used to analyze regulatory and memory subsets from eight mice (two arrays per littermate pair, including dye swaps, were used for each comparison).

Gordon's graduate student Peter Turnbaugh analyzed the genomes of gut microbes in two pairs of mice.

The long day of filming resulted in final footage of several minutes of Fasano enthusiastically explaining intestinal permeability, including shots of the two pairs of mice running around in their cages.

A complete mouse phenotype analysis was conducted in two pairs of OGR1 KO and FL mice (8 weeks old, one male and one female in each group) at the Mouse Phenotypes Shared Resource, OHIO State University, Columbus, OH.

The results of the intra- and inter-species comparisons indicate that there are significant differences (p < 0.01) in the CoER in a short CD range (0 – 20 kbp) between any pair among worm, mammal (human, rat and mouse), fruit fly and yeast except two pairs of (worm and rat), and (mouse and fruit fly) (Table 4).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: