Sentence examples for methods with primers from inspiring English sources

To detect spoilage ff efficient methods such as MALDI-TOF MS, fluorescent staining, Fourier transform infrared spectroscopy analysis, hyperspectral imaging analysis and nucleic acid molecular methods with primers designed from single-copy or multi-copy genes, are proposed.

PCR was performed using standard methods with primers flanking EGFP at the 5' end and Fmn1-IV exon 6 at the 3' end: 5' CAAAGACCCCAACGAGAAGC and 5' AGGGATTTCATAGAGAATTTAG.

Methods, with primers listed in Supp.

The cDNA synthesis and PCR was performed by standard methods with primers for human TGF- α, HGF and EGF.

The resulting clones were sequenced by Sanger sequencing methods with primer-walking by a commercial company (Macrogen, Europe).

To detect CCND1 mRNA levels, we used the SYBR Green method with primers CCND1-5.1 and CCND1-3.1.

Purified DNA was measured by qPCR (as previously described in the qRT-PCR method) with primers shown in Table 5.

qRT-PCR was performed using a two-step method with primers listed in supplementary table S7, Supplementary Material online.

The complete genome was amplified using a single amplification method with primers P1 (1821–1841 from EcoRI site) and P2 (1825–1806 from EcoRI site), with modifications in the cycling conditions [ 30].

To detect the transcriptional level of RoR and p53, we used the SYBR Green method with primers listed in Supplementary information, Table S1.

DNA was extracted from filter paper by using the saponine-chelex method, and the PCR was performed according to a described method with primers specific for the 18S rDNA region.