Sentence examples for method using following from inspiring English sources

Suggestions(1)

Exact(1)

Particular genotypes for GPX1 and SEP15 were identified on the basis of PCR-RFLP method, using following restriction enzymes: DDeI (Promega, Madison, WI, USA) fo GPX1 and FspBI (Fermentas, Waltham, MA, USA) for SEP15.

Similar(59)

For double-color immunostaining, an indirect immunoalkaline phosphatase method was used following the indirect immunoperoxidase procedure described above.

Rapid test methods were used following a pretest counselling session.

Biotinylated anti-mouse antibody was used as secondary antibody and streptavidin horseradish peroxidase (Zymed laboratories, San Francisco, CA) methods were used following the instructions provided by the manufacturer.

DNA manipulations were carried out using established methods [ 50], and used following the manufacturers' instructions.

Immunohistochemistry was performed by the means of the streptavidin-biotin-peroxidase complex method using the following primary mAbs for: CD20, α-SMA and CD31 (Dako, Glostrup, Denmark).

The gene was amplified by PCR method using the following two primers with NheI and HindIII restriction sites: TATATAGCTAGCATGTCCACGACGG (upper primer, NheI cutting site as underlined); CGTCGCAAGCTTGAGCTACTTAAC (lower primer, HindIII cutting site as underlined).

Sensitivity and specificity were calculated by the detection method using the following formulae.

The data were analyzed on the basis of Laviron's method, using the following simplified equation.

The adsorbed amounts of the polymer were determined by the static method using the following polymer concentrations: 10, 20, 30, 50, 70, 100, and 200 ppm.

We recalibrated the Jaffe method to the enzymatic method using the following formula: serum creatinine (mg/dl, enzymatic method) = 1.02 × serum creatinine (mg/dl, Jaffe method) − 0.25 (r = 0.9996).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: