Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
We are unable to recommend the use of Upright Standing in single leg stance as a SubMVC method to normalise EMG to if the muscles adductor longus and/or semitendinosus are the intended muscles of investigation.
One of the main questions to address is effectively the relevance of the use of HKGs as an appropriate method to normalise RT QPCR results.
Similar(58)
In contrast, microarray analysis assesses the transcript abundance of tens of thousands of genes, thus it has required the application of statistical methods to normalise the distribution of signals and also requires correction for large samples sets, so called false discovery rate correction [ 3, 4].
138 There has also been a lack of uniformity of the comparator group, with controls consisting of healthy individuals in some studies and 'symptomatic control' patients in others and furthermore many of these studies used different methods to normalise miRNA data.
Initially, a set of calibration STM strains with VNTR loci of different sizes were initially sequenced to verify the method and to normalise the raw data to be obtained from prospective MLVA typing.
The standard curve method was used to normalise the gene expression data.
The median-of-ratios method was used to normalise the data to correct for unequal sequencing depth; this procedure was implemented as a default in DESeq2.
The ΔΔCp method was applied to normalise to the expression of TERT mRNA, using both the expression of β actin and a non-tumour brain tissue sample.
The TMM method was used to normalise read counts and differential expression tested for using a paired generalized linear model design with the Bioconductor version 2.11 edgeR package [ 24].
The following primer pairs were used: Hum Collagen 1, forward GTTGTGCGATGACGTGATCTGTGA and reverse TTCTTGGTCGGTGGGTGACTCTG; Hum Collagen 3, forward GCTGGCTACTTCTCGCTCTG and reverse TCCGCATAGGACTGACCAAG; GAPDH, forward GGGGCTCTCCAGAACATCATCC and reverse ACGCCTGCTTCACCACCTTCTT.The 2-ΔΔCt method was used to normalise transcription to GAPDH and to calculate the fold induction relative to controls.
Delta Ct methods were used to normalise the expression of the chosen genes of interest against the average of the endogenous control genes.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com