Sentence examples for mere size from inspiring English sources
The present trend is away from mere size & power.
But, Russell cautions, "there is no reason to worship mere size".
In the real world, intimidating "mere size" has become, when not sin itself, the occasion of sin.
In the majority opinion, Judge Michael Daly Hawkins wrote: "Although the size of this class action is large, mere size does not render a case unmanageable".
Wal-Mart is the world's largest private employer, and as the Ninth Circuit wrote, "mere size does not render a case unmanageable".
Pores with undulating diameters have the potential to move the use of resistive pulse technique beyond mere sizing of particles, enabling the use of these structures for enhanced biomolecule detection.
Another important finding of our study is the fact that alterations (especially loss) to β-cell mass can affect only nβ (a mere islet size growth or β-cell death at islet peripheral, for example), or both nβ and nc (β-cell death across the whole islet, for example), which are independent cytoarchitectural parameters that are both important to function.
The current study is expected to have reasonable statistical power (>0.5) to detect associations for about half of these loci (16 out of 34), implying that the general lack of replication is unlikely to be a mere sample size issue.
Nevertheless, these data imply that though plaque dimensions will in general be sufficient for imaging-target visualisation, focussing on mere plaque size entails unsatisfactory prognostic information for clinical use.
Primer Sequence Length meres Standard Product size BinA 5'ATGAGAAATTTGGATTTTATT 3' 21 1593 M 1.1 kb 5'TTAGTTTTGATCATCTGTAAT 3' 21 1593 M BinB 5'ATGTGCGATTCAAAAGACAAT3' 2159393 M 1.3 kb 5'TCACTGGTTAATTTTAGGTA 3' 20 1593 M Mtx1 5'ATGGCTATAAAAAAAGTATTA3' 2159393 M 2.6 kb 5'TACTATCTAGGTTCTACACC 3' 20 1593 M .
