Peptide mapping of the 48-mer peptide reveals that this increased affinity is also due to an intermediate peptide sequence located between the N-terminal end of the 17-mer and the a-exosite sequence, revealing a new cooperative exosite for BoNT/A substrate binding.
Two short oligonucleotides each with an intramolecular complementary sequence were synthesized to form a double-stranded 10-mer (ds10-mer, GCGATCACCGTTTCGGTGATCGC) and a double-stranded 22-mer (ds22-mer, GCGATCACCGTAATGCTAGCGCTTTTGCGCTAGCATTACGGTAGATCGC), respectively.
More specifically, a minimal 17-mer and a longer 48-mer peptide reaching the previously identified α-exosite were synthesized, with the latter showing significantly higher affinity for BoNT/A.
It also continues a welcome recovery after she suffered a second-round defeat at an ITF tournament in Cagnes-sur-Mer and a bad-tempered loss in qualifying in Rome.
Frequency analysis revealed that k-mer size was inversely proportional to the occurrence of k-mers in the different conserved regions, suggesting a stringency relationship; high numbers of duplicate reactions were observed with short k-mers, and a lower proportion of sequences were obtained with large ones, with the best results obtained using 12-mers.
As reported before, the wild-type SsoRadA catalyzed homology-dependent D-loop formation between a 32P-labeled oligonucleotide P1656 (50-mer) and a supercoiled plasmid, GW1 [26], [26].
Heparin, dermatan sulfate 4-O-sulfated (DS 4S) 12-mer and a mixture of chondroitin sulfate 4-O or 6-O-sulfated (CS 4S/6S) 12-mers were dosed at 50 µg/ml concentration.
Retroviral vectors (pHUSH) encoding human GpIbα shRNA 29-mers and a puromycin-selectable cassette (Cat. Numbers TR12692) were obtained from Origene, Inc. (Rockville, MD) and 100 units/ml Penicillin G + 100 µg/ml Streptomycin as previous described [35].
Two linear 7-mer and 12-mer and a constrained version of the peptide library were used for the selection.
Also, MAP score can not be used to evaluate the similarity between a k-mer and a motif model, which is essential in computational motif discovery exercises.
