Sentence examples for mentioned forward from inspiring English sources

Fulham boss Martin Jol has said he will make "a few changes" for the Burton match and mentioned forward Hugo Rodallega and midfielder Ashkan Dejagah, two players who have not had any Premier League game time so far this term, specifically.

A 2010 report by the Government Accountability Office mentioned forward operating locations in Isiolo and Manda Bay, both in Kenya. .

The amplification of the truncated bfrb gene (encoding residues 1 167) was carried out by using the above mentioned forward primer and 5'gaattcaagcttttactacgccacatccacttcacg 3' containing the HindIII site as the reverse primer.

Barnes mentioned Grizzlies forward Tony Allen as a similarly hard-nosed player whom he looked forward to playing alongside.

As mentioned earlier, forward scattered light is the light whose direction deviates from the initial ray direction by a tiny amount; typically 0.5 to 5 degrees.

He did not identify who the "locks" were, but Burke mentioned multidimensional forwards like the Rangers' Chris Drury, the Devils' Jamie Langenbrunner, David Backes of St . Louisand Dustin Brown of Los Angeles, who can score, check or grind.

We assume that this is an intrinsic property of transcriptional networks and cannot be explained by the incompleteness of the underlying knowledge, since other patterns of similar complexity (e.g., the mentioned feed-forward loop) are not consistently under-represented among these three networks.

It's also worth mentioning Portsmouth forward Lomana LuaLua, who arrived in Britain with his father at the age of nine as an asylum seeker from the Democratic Republic of Congo (then Zaire).

The vertical axis in usual notation mentions swimming (forward) velocity in cm/s while the horizontal axis is denoted by two parameters, TBF and PW.

Polley and Fay mention a forward genetic screen (from phenotype > gene) undertaken in previous work and describe a reverse genetic screen (from gene > phenotype) using RNAi.

The technologies that the N.T.S.B. mentioned consisted of forward collision warning, lane departure warning, adaptive cruise control, automatic braking and electronic stability control (on vehicles with a gross vehicle weight rating of 10,000 pounds or more).