Sentence examples for mentioned above with the same from inspiring English sources

Exact(1)

Generating foams of all surfactants mentioned above with the same foaming conditions we found that stable foams are obtained when the head group is capable of forming intersurfactant H-bonds.

Similar(59)

Exclusion criteria were the same as mentioned above with the addition of a PMI ≥ 4 days.

The interview lasted 35-90 minutes and was carried out as mentioned above, starting with the same open-ended question as in the first interview.

This makes a huge difference compared with the case mentioned above, when the same laboratory both performs the experiments and present inference algorithms with alleged generalizability.

We ran both 3B and FID3B with the two datasets mentioned above for the same 320 iterations and recorded the numbers of retained and discarded positions (Fig. 6).

The problem for Facebook: other apps, like those mentioned above, have the same functionality.

4 The Usipetes and the Tencteri, mentioned above, were in the same case.

But it probably needed a Netflix original series as opposed to a feature film subject to regular censorship to get away with lines like the one mentioned above, with a strong cuss word in the same sentence as "Bhagwaan".

Domestically, the same two methods mentioned above are used.

On that same day, the nobles mentioned above, with others, gathered to sign the document that has become known to history as the Boulogne agreement.

Intermediate vector pC3.3 was constructed based on pC3.2 by means of the same mutation protocol mentioned above with primer set 5′CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTTCGAAGGCGGTAATACGGTTATCCACAG 3′ and 5′ AGCCATAGAGCCCACCGCA 3′, by which T7 terminator (underlined sequence) for prokaryotic expression was introduced into a site downstream BGH Poly(A) site.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: