Sentence examples similar to mediated off from inspiring English sources

Suggestions(1)

Similar(58)

All published studies have suggested that the CRISPR/Cas9 mediated off-target mutagenesis could vary depending on the sgRNA design and target sequence.

FGF23 itself has been shown to mediate off-target direct end-organ toxicity in the heart promoting cardiomyocyte hypertrophy.

From the current data it is hard to deduce whether AID implicates on CLL development by single mutagenic off-target events contributing to initial malignant transformation or whether AID implicates on clonal evolution of CLL by constantly mediating off-target DNA damage during disease progression.

To rule out the possibility that the effect of her8a morpholinos was mediated by off-targeted apoptosis, all her8a MOs were co-injected with a p53 MO and we did not observe any detectable deviation in Her8a morphants with or without p53 MO (Fig. S6).

However, it has been claimed that such effects are mediated by off-target interactions.

Next, we investigated whether the effects of SP600125 depend on the inhibition of MPS1 or are mediated by off-target mechanisms.

Treatment of cells with GSK2606414, a potent PERK inhibitor, provided a protective effect against IPA toxicity, providing further support for the model that IPA toxicity is mediated by off-target inhibition of PERK.

Therefore, the antiproliferative properties of the BK and IK1 channel blockers are likely mediated by off target actions.

A p53 morpholino with the sequence GACCTCCTCTCCACTAAACTACGAT (Gene Tools, LLC) was used to rule out the possibility that the effect of her8a MOs was mediated through an off-targeted p53 activation.

With a finite oxygen budget, some prioritization must take place [ 10], which results in trade-offs mediated by oxygen availability.

Two arguments could support the hypothesis of a trade-off mediated by testosterone between response to phytohaemagglutinin and secondary sexual character in A. scherman.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: