Sentence examples for measures a gagging from inspiring English sources

Exact(1)

Some protesters wore tape covering their mouths and carried placards calling the measures a "gagging law".

Similar(59)

HIV-1 copy numbers in PBMCs were measured with a gag-specific Taqman assay (upstream primer: 5' AAAGAGACCATCAATGAGGAAGCT 3', downstream primer: 5' TCTGGCCTGGTGCAATAGG 3', probe: 5' TGCACTGGATGCACTCTATCC CATTCTG 3').

To measure the breadth of the HIV-Gag specific CMI response, we harvested splenocytes from both C57BL/6 (Figure 7A) and Balb/c (Figure 7B) mice co-injected with the Ad-Gag and Ad-GFP/rEA vectors, and stimulated the cells ex vivo with peptide pools each containing 2-4 HIV-Gag specific overlapping 15mer peptides spanning the entire HIV-Gag protein sequence.

GAG chemical exchange saturation transfer (gagCEST) measures GAG concentrations by using the GAG molecules as endogenous contrast agents [ 25– 28].

dGEMRIC measures glycosaminoglycan (GAG) concentrations in articular cartilage and GAG content can change quickly, therefore dGEMRIC can be used to determine if altering BML natural history improves cartilage biochemistry.

Vacuolization is a measure of glycosaminoglycans (GAGs) storage in the brain of affected MPS-IIIA mice.

A DMMB assay measuring the GAG release in the cartilage explant culture time course indicated that, although inflammatory MMPs are significantly reduced by carprofen, equivalent GAG release occurs when comparing IL-1β and carprofen + IL-1β-treated explants cultured for up to 12 days.

Cartilage tissue growth and chondrocytic phenotype maintenance of each cell type were examined by cell morphology, histochemical analyses, expression of collagen type II and quantitative measures of glycosaminoglycan (GAG) content.

To examine viral reservoirs, we isolated PBMCs from each monkey at 40 weeks post-infection and measured SIV Gag DNA copy numbers by quantitative PCR.

More importantly, we could not detect viral loads in these monkeys even though we could measure SIV Gag DNA in PBMCs, suggesting that this model does reflect some phenotypic aspects of latently-infected cells.

Viral replication was assessed by measuring p24 Gag production in cell-free supernatant with ELISA as described above.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: