Sentence examples for measured using primers from inspiring English sources

Mucosal RNA was extracted, and relative band intensities were measured using primers for SGLT-1.

PCR analysis of virion DNA produced by NERT revealed that the first strand transfer reaction (1stST) was inefficient in intact virions, with minus strand strong stop DNA (ssDNA) copy numbers up to 200 times higher than post-1stST products measured using primers in U3 and U5.

p16 DNA methylation was measured using primers and conditions developed by Shaw et al [53].

Total PFV DNA was measured using primers in the gag gene described previously [15].

Transcription of FGSG_3531.3, was measured using primers FG_3531_ORF_F and FG_3531_ORF_R.

The expression of MtSERK3 was measured using primers that would amplify all putative splice variants of this gene.

The relative mRNA levels of waaA were measured using primer extension in the wild-type Y.

Drosomycin (FlyBase annotation symbol: CG10810) and tbp (FlyBase annotation symbol: CG9874) expression levels were measured using primer pairs: Drs and Drs ; Tbp and Tbp.

All KATP channel subunits were measured using these primers apart on SUR2A that was measured by combining SUR2A rat (Table 1) and mouse (sense: ACTATGGAGTCCGAGAACTA, antisense: AGGTTTGGACCAGTATCACA) primers.

Transcript levels were measured using the primers pairs shown underneath.

Ccl21 and Ccl25 expression were measured using the primers 5′ GTGATGGAGGGGGTCAGGA with 5′ GGGATGGGACAGCCTAAACT and 5′ TTACCAGCACAGGATCAAATGG with 5′ CGGAAGTAGAATCTCACAGCAC, respectively.