Sentence examples for matrix which targeted from inspiring English sources

Exact(1)

Stainless steel stents were coated with a polymer matrix, which targeted neointimal hyperplasia or a precursor.

Similar(59)

We mainly focused on the two most common N-terminal sorting signals: Signal Peptides (SP), targeting proteins to the endoplasmic reticulum and Matrix Targeting Signals (MTS) which target proteins to the matrix (inner compartment) of the mitochondria.

Many novel therapeutics have been developed which aim to target this process by acting as either angiogenesis inhibitors (e.g. by blocking the action of vascular endothelial growth factor) or as vascular disrupting agents, which target the extracellular matrix [2],[3].

This compound symmetry covariance structure, also known as essential τ-equivalence, is the covariance matrix of parallel items each of which targets the underlying true score for a unidimensional construct.

Moreover, they can also increase the success ratio of bandwidth allocation, which targets at simultaneously satisfying as many flows of the traffic matrix as possible.

Niecza, which targets the Common Language Runtime.

TAS2 produces TATTCGAGTATATGCAAAAGA, which targets just TAS1A.

Fibronectin, a component of the extra-cellular matrix which is a target gene of TGF-β1, has been suggested to play an important role in epithelio-mesenchymal interactions during axolotl limb regeneration [15].

At the same time, this observation raises the question as to whether differentiation of activated PLFs at the bone surface results in the ability of the cells to resorb osseous matrix, which is the target tissue in APL.

B = [b (1),⋯,b (L)] T  denotes the target matrix, which contains the estimated parameter of Doppler frequency f d.

where F0 is the target matrix, which is chosen to be positive definite (and therefore nonsingular) and well-conditioned, and we assume it herein to be given by F 0 = 1 K Tr ( Σ ̂ x ) I K.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: