Sentence examples for materials for additional from inspiring English sources

Citing the audit's finding that department employees improperly disseminated materials for additional tests, she said, "I find the fire chief's response to us inadequate".

See Supplementary Materials for additional details.

Please see the Supplemental Methods and Materials for additional information.

Cohort enrollment was based on the rules presented in Table 1 (see Supplementary Materials for additional information).

See the Supplementary Materials for additional discussion of the normalization and statistical testing methods used in this work.

Each level represents a 2-fold increase in raster-based VMT, and study participants were assigned the value for their residence (see Supplemental Materials for additional details).

The evaluation had to factor in the relative difficulty in obtaining sample material for additional extractions, and also account for a high rate of PCR failures, given that retrieving results from four positive PCR reactions could for some extracts easily involve 6 10 PCR setups.

Sense1: GATGGATCCAAAACTACATGAAACCT and anti-sense1: CGTGACTCGAGC TGCTTCCTGC as outer primers and sense2: GATGGATCCAGCCTATTTAATACCAC and anti-sense2: CGTGACTCGAGAGTTAAGTTGATCTTGCAA as inner pair of primers to amplify a 650 bp fragment spanning the surface-transmembrane region of the envelope genes, (see Table S2 in the supplemental material for additional oligonucleotide primer sequences).

See Supplementary Material, for additional methods.

Materials and methods are shown in online supplemental material (for additional details).

Please see the Supplementary Material for additional information about tool usage and features.