Exact(2)
The difference in the amount of ablated material was compensated for by introducing a mass coefficient.
Voiding in weak spots was not observed in thin films of polymers crystallized with a free surface because the deficiency of the crystallizing material was compensated here by the thinning of the film.
Similar(58)
The low thermal conductivity of the porous ceramic redox material is compensated for by changing the profile of the fixed bed.
Differences in starting material were compensated by normalisation to the endogenous reference gene GAPDH (forward primer: GTATTGGGCGCCTGGTCACC, reverse primer: CGCTCCTGGAAGATGGTGATGG).
Differences in the quantity of starting material were compensated by normalization with the housekeeping genes beta-2-microglobulin (B2M) and ribosomal protein L19 (RPL19).
Differences in the quantity of starting material were compensated by normalization with the housekeeping genes HPRT (forward primer: CTCATGGACTGATTATGGACAGGAC and reverse primer: GCAGGTCAGCAAAGAACTTATAGCC) and GAPDH (forward primer: GTATTGGGCGCCTGGTCACC and reverse primer: CGCTCCTGGAAGATGGTGATGG). Normalized fold-changes between mutant and normal samples were calculated by the REST XL software.
Organic materials [1] emerged as a very attractive solution for this scope, their lower efficiencies with respect to inorganic materials being compensated by lower fabrication costs and higher flexibility.
Aside from the physical coverage of the maps usually being lower in the intraspecific maps, these results suggest either that ascertainment bias was not an important factor in the almond/peach materials or that it was compensated for by a higher level of polymorphism compared to peach materials alone, giving a similar or higher marker number and coverage.
As the construction costs of the privately funded project ballooned from $500,000 to $650,000 due to the change in materials and contractors, the difference was compensated for by a shift in funds from the advertising budget.
James Harrison, a saidLeaneithersed lawyer who answered questions Monday on behalf of Californians for Safe Neighborhoods and Schools, said the videos were produced by Michael Skolnik, political director for hip-hop label owner Russell Simmons and who also organized Artists for 47.
First, the crew was compensated.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com