Sentence examples for material is compensated from inspiring English sources

The low thermal conductivity of the porous ceramic redox material is compensated for by changing the profile of the fixed bed.

The difference in the amount of ablated material was compensated for by introducing a mass coefficient.

Differences in starting material were compensated by normalisation to the endogenous reference gene GAPDH (forward primer: GTATTGGGCGCCTGGTCACC, reverse primer: CGCTCCTGGAAGATGGTGATGG).

Differences in the quantity of starting material were compensated by normalization with the housekeeping genes beta-2-microglobulin (B2M) and ribosomal protein L19 (RPL19).

Voiding in weak spots was not observed in thin films of polymers crystallized with a free surface because the deficiency of the crystallizing material was compensated here by the thinning of the film.

Differences in the quantity of starting material were compensated by normalization with the housekeeping genes HPRT (forward primer: CTCATGGACTGATTATGGACAGGAC and reverse primer: GCAGGTCAGCAAAGAACTTATAGCC) and GAPDH (forward primer: GTATTGGGCGCCTGGTCACC and reverse primer: CGCTCCTGGAAGATGGTGATGG). Normalized fold-changes between mutant and normal samples were calculated by the REST XL software.

Organic materials [1] emerged as a very attractive solution for this scope, their lower efficiencies with respect to inorganic materials being compensated by lower fabrication costs and higher flexibility.

By means of the proposed method, the estimation error which comes from the different temperatures of the interconnection materials in the module is compensated.

Low-solidity HAWTs have a low proportion of material within the swept area, which is compensated by a faster rotation speed used to fill up the swept area.

He is compensated very well.

And that goodness is compensated.