Sentence examples for material for additional from inspiring English sources

But instead of prizes, seniors got back only promotional material for additional schemes, she said.

The evaluation had to factor in the relative difficulty in obtaining sample material for additional extractions, and also account for a high rate of PCR failures, given that retrieving results from four positive PCR reactions could for some extracts easily involve 6 10 PCR setups.

Sense1: GATGGATCCAAAACTACATGAAACCT and anti-sense1: CGTGACTCGAGC TGCTTCCTGC as outer primers and sense2: GATGGATCCAGCCTATTTAATACCAC and anti-sense2: CGTGACTCGAGAGTTAAGTTGATCTTGCAA as inner pair of primers to amplify a 650 bp fragment spanning the surface-transmembrane region of the envelope genes, (see Table S2 in the supplemental material for additional oligonucleotide primer sequences).

See Supplementary Material, for additional methods.

Materials and methods are shown in online supplemental material (for additional details).

The results are shown in online supplemental material (for additional details).

Citing the audit's finding that department employees improperly disseminated materials for additional tests, she said, "I find the fire chief's response to us inadequate".

Citing the audit's finding that department employees improperly disseminated materials for additional tests, she said, "I find the fire chief's response to us inadequate". "I think we need to dig further into how broadly this permeated the Fire Department and other examinations," said Kuehl, who is based on the Westside.

See Supplementary Materials for additional details.

Please see the Supplemental Methods and Materials for additional information.

Cohort enrollment was based on the rules presented in Table 1 (see Supplementary Materials for additional information).