Exact(2)
Until recently, scientists believed that these stones functioned as a gastric mill to aid ingestion of plant material, compensating for its inability to chew, as it is the case in many modern birds.
The small deviation from a linear relationship observed could be due to a residual activity of damaged material compensating a stronger toxic effect, or due to efficient repair of the damage masking the true rate of toxic damage accumulation.
Similar(58)
Simultaneously, a burnable absorber material is loaded in replacement of fertile material to compensate for reactivity drop during the fuel depletion.
The low thermal conductivity of the porous ceramic redox material is compensated for by changing the profile of the fixed bed.
As a result, it favours a higher dissolution of CaF2 from the source material to compensate for requirement of Ca2+ ions in the chemical equlibria (Freeze and Cherry 1979).
Here, we report using Li2S as a cathode pre-lithiation material to compensate for the loss of active lithium and, consequently, enhance the specific energy of lithium-ion batteries.
The ability of this material to compensate for active lithium is investigated by coating a typical cathode LiFePO4 as an example, with the core-shell Li2S/KB/PVP via a simple and non-toxic coating method.
The difference in the amount of ablated material was compensated for by introducing a mass coefficient.
Differences in starting material were compensated by normalisation to the endogenous reference gene GAPDH (forward primer: GTATTGGGCGCCTGGTCACC, reverse primer: CGCTCCTGGAAGATGGTGATGG).
Differences in the quantity of starting material were compensated by normalization with the housekeeping genes beta-2-microglobulin (B2M) and ribosomal protein L19 (RPL19).
Voiding in weak spots was not observed in thin films of polymers crystallized with a free surface because the deficiency of the crystallizing material was compensated here by the thinning of the film.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com