Sentence examples for masses were collected from inspiring English sources

Suspected WBC egg masses were collected in Franklin county this week.

Mice were sacrificed 22 days after cell injection and tumor masses were collected and weighed.

The plasma protein identifications with experimental molecular masses were collected by Jin Young Kim et al [17].

After O2 readings were obtained, masses were collected by divers and transported on ice back to McMurdo Station and maintained in running seawater at −1°C.

Precursor masses were collected at high resolution; MS/MS spectra were triggered for the ten most abundant ions and acquired in the linear ion trap.

Egg masses were obtained mostly from adults kept in the laboratory, but in some cases (particularly for Antarctic taxa, which took considerably longer to lay egg masses in the laboratory) masses were collected in the field by SCUBA divers.

Erythrocytes, which are released from the blood masses, are collected in the most spacious part of the ventral blood vessel, i.e., at the border between the larval esophagus and stomach diverticulum (Additional file 2).

Varying the parameter "number of retained masses per retention time" (see sets 2, 4 and 5) has little influence on the number of detected peaks, but does strongly influence the alignment result: If only very few masses are retained (e.g. five), only 3.7 out of 19 spiked compounds are found back on average, compared with 18.4 when 100 masses are collected (set 5).

Pieces of tissues of muscle, heart, liver and adipose mass were collected after 6 h or 2 months, RNA was extracted by Trizol reagent, and RT-PCR against the mouse epsilon chromosome was performed (Fw:5'GATGGTGCCTCATGGAATCT; Rw:5'AAATATGCCAAGAAGGAGAGCC).

Tissue samples from the mass were collected by an exploratory laparotomy in order to conduct further histopathological evaluation.

Samples of the subcutaneous mass were collected, and H&E staining and CK-18 IHC were performed for pathologic analysis of the mass.