Sentence examples for mass were collected from inspiring English sources

Pieces of tissues of muscle, heart, liver and adipose mass were collected after 6 h or 2 months, RNA was extracted by Trizol reagent, and RT-PCR against the mouse epsilon chromosome was performed (Fw:5'GATGGTGCCTCATGGAATCT; Rw:5'AAATATGCCAAGAAGGAGAGCC).

Tissue samples from the mass were collected by an exploratory laparotomy in order to conduct further histopathological evaluation.

Samples of the subcutaneous mass were collected, and H&E staining and CK-18 IHC were performed for pathologic analysis of the mass.

For the limited data set where mass was collected concurrently on the days of speciation collection (n = 279), no association was observed between PM2.5 mass and all-cause mortality.

For transmission electron microscopy, mycelia mass was collected, fixed for 1 hour at 4°C in 50 mM sodium phosphate buffer (pH 7.2) containing 3% glutaraldehyde and 2% paraformaldehyde, and washed three times, 10 min each time, with 0.1 M phosphate buffer (pH 7.2).

After 4 h, the cell mass was collected again.

Fungal mass was collected, dried and frozen in liquid nitrogen.

Plates were grown overnight and bacterial mass was collected with a sterile loop and cryopreserved.

Fluid from the axillary mass was collected by fine-needle aspiration for bacteriologic investigations.

Equal cell mass was collected, and plasmid DNA was extracted within an equal volume for DNA gel analysis.

Growing tissue at the edge of the mass was collected and placed in the petri dish filled with saline.