Sentence examples for mass was collected from inspiring English sources

For the limited data set where mass was collected concurrently on the days of speciation collection (n = 279), no association was observed between PM2.5 mass and all-cause mortality.

For transmission electron microscopy, mycelia mass was collected, fixed for 1 hour at 4°C in 50 mM sodium phosphate buffer (pH 7.2) containing 3% glutaraldehyde and 2% paraformaldehyde, and washed three times, 10 min each time, with 0.1 M phosphate buffer (pH 7.2).

After 4 h, the cell mass was collected again.

Fungal mass was collected, dried and frozen in liquid nitrogen.

Plates were grown overnight and bacterial mass was collected with a sterile loop and cryopreserved.

Fluid from the axillary mass was collected by fine-needle aspiration for bacteriologic investigations.

Pieces of tissues of muscle, heart, liver and adipose mass were collected after 6 h or 2 months, RNA was extracted by Trizol reagent, and RT-PCR against the mouse epsilon chromosome was performed (Fw:5'GATGGTGCCTCATGGAATCT; Rw:5'AAATATGCCAAGAAGGAGAGCC).

Tissue samples from the mass were collected by an exploratory laparotomy in order to conduct further histopathological evaluation.

Samples of the subcutaneous mass were collected, and H&E staining and CK-18 IHC were performed for pathologic analysis of the mass.

In order to estimate the goethite to ferrihydrite ratio, an XRD pattern from a mixture of known goethite and ferrihydrite masses was collected, and by comparing to Fig. 2(d), the goethite content of 4 nm-6LF was estimated to be approximately 10 wt %.

Mice were sacrificed 22 days after cell injection and tumor masses were collected and weighed.