Sentence examples for marking using the from inspiring English sources

From 2 May to 10 August 2005 at the Yozawa and Kobotoke Rivers, 223 males of newly emerged C. cornelia (the ventral side of the thoracic region and the ventral side of the abdominal tip were yellow) were captured and released at the capture site after marking using the same method as for M. pruinosa.

The silicon nanocrystals were marked using the freehand selection tool in ImageJ [17].

The facial axis of each tooth crown (FACC) was marked using the "section" tool, in all cases making sure that the C-plane was aligned correctly.

The regions of processes where SNPH are overexpressed were selected and marked using the nearest alpha-numeric finder in the grid.

It should be noted that, in Fig. 6a, the shear cracks are marked using the red colour while the blue colour is used to denote the boundaries and the tensile cracks.

It should be noted that, in Fig. 4b, tensile crack is marked using the red colour while the compressive crack and the boundaries are denoted using the blue colour.

The 3′ end of the IME-EF4 genome was marked using the primer P1 (5′–CTCTAGTTTGTTGCGTGCGTAAATC–3′).

The 5′ end of the IME-EF4 genome was marked using the primer P4 (5′–AGGTACGGACCGCAATGGGTTGGGA–3′).

The effect was more marked using the cells selected after viral infection.

In short, the peripheries of lesions were marked using the Dual Knife (KD-650 L; Olympus).

PCR duplicates were marked using the program MarkDuplicates, which is part of Picard.