Sentence examples for markers were isolated from inspiring English sources
Cells expressing key β-cell markers were isolated by fluorescence-activated cell sorting after staining for high zinc content using the vital dye, Newport Green.
For β-glucuronidase activity analysis QC markers were crossed to rlk902 and plants homozygous for the rlk902 mutations well as for transgene markers were isolated from the F2 population and analyzed in the next generation.
Eight microsatellite markers were isolated using next-generation sequencing.
Methods and Results: Seventeen microsatellite markers were isolated by a microsatellite-enriched library protocol.
A total of 80 unique DNA fragments spanning AFLP markers were isolated and sequenced.
Fourteen microsatellite markers were isolated and characterized from A. aurantiaca genomic libraries enriched for di-, tri-, and tetranucleotide repeat motifs.
Given that markers are isolated from coding regions, conservation is expected to be high, such that these EST SSR markers are generally also transferable to related species (e.g. Gupta et al. 2003).
By using two generally accepted criteria for the isolation of EPCs, such as uptake of acetylated low-density lipoprotein (LDL) and binding of ulex-lectin, a CD34− population expressing monocyte/macrophage/dendritic markers was isolated from human peripheral blood (Rehman et al, 2003).
The yeast selection cassette and pKOS-65 were co-transformed into yeast and clones that had undergone homologous recombination to replace the 1005bp genomic region containing exons 2 3 with the yeast selectable marker were isolated.
The percentage was then multiplied by the number of total viable cells isolated per gram of tissue to determine how many viable cells positive for each marker were isolated per gram of tissue.
The 5 S rRNA gene, which is a conserved component of the large ribosomal subunit, was isolated from Japanese flounder by [ 28] (AB154836-AB154839), and a microsatellite marker was isolated from the variable non-transcribed spacer (NTS) region (Marker name: JF5SrRNA, Forward primer: TGCACCTTGAGATTGATTTTGGAACA, Reverse primer: CACCCACAATACCTCCTTTCAGTCTT).
