Sentence examples for marker was detected from inspiring English sources

No population-specific marker was detected and the differential pattern of variation between vars.

If more than one significant interaction with a particular marker was detected, also higher-order interaction terms between markers were included.

This profile did not correlate with any logical combination of MCTs for any Salmonella serogroup/serovar outlined in Figure 5, and only the internal control marker was detected.

HEV IgM persisted for the longest period until early convalescence about 16 weeks after onset of symptoms and the marker was detected among 82 of the patients.

The expression of each molecular marker was detected by PCR using the following specific primers: XmyoDa, upstream, agctccaactgctccgacggcatga, and downstream, aggagagaatccagttgatggaaaca, Xbra, upstream, ggatcatcttctcagcgctgtgga, and downstream, gttgtcggctgccacaaagtcca.

No specific staining with AT8 antibody (phosphorylated tau marker) was detected and control immunostaining using only secondary antibodies showed no unspecific staining.

It is of crucial importance that the corresponding marker is detected in the two planes and that a minimum of three corresponding markers are detectable in each segment.

Once the marker is detected then the pose of the camera can be obtained and models can be rendered on the camera image.

Finally the levels of protein carbonyls, as an oxidative stress marker, were detected.

Only two additional donor segments, each detected by a single marker, were detected by adding 136 more markers.

High levels of ALDH, a functional CSC marker, were detected in the resistant cells.