Sentence examples for marker sequence from inspiring English sources

Interestingly, the marker sequence of one of the var.

Marker-human alignments were discarded if the marker sequence aligned with two or more regions of the human genome with similarly high BLAT scores.

NCBI blast of the SCAR marker sequence showed no homology to any of the earlier identified sequences in GenBank.

Primer pairs targeting the SCAR marker sequence were designed, which enabled species-specific detection and avoided cross-amplification of other species of Serranidae fish.

The LAMP primer set was designed based on a RAPD marker sequence and positive products were amplified only from F. mangiferae isolates, but not from any other species tested, showing a high specificity of the primer sets.

The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence.

Results of these studies and the wealth of gene and marker sequence information from the Human Genome Project could when brought together provide the researcher with new etiological avenues to explore.

The PCR product was transformed using standard methods [75] and TIF4631 or TIF4632Δ strains were selected for on Synthetic Complete (SC) (-ura) and confirmed by PCR with forward primers ∼200 bp upstream of the replaced ORF (TIF4631: CCGCGTTCTCTGTGTGCAACGGATG; TIF4632: GAGGTAAACACAGCAAACGACCAC) and reverse primers within the URA3 marker sequence (GCTTGGCAGCAACAGGACTAGGATG).

Meanwhile, by aligning the marker sequence to the "Darmor" genome of B. napus [ 23], an additional 156 marker sequence could be assigned to certain ancestral blocks.

The hybridization probe was designed based on the MFLP-derived PhtjM2 marker sequence.

The bl2seq tool at NCBI [ 50] was used to examine DArT marker sequence similarity/redundancy.