Sentence examples for marker pin from inspiring English sources
We perpendicularly inserted a marker pin, which had a spherical red-colored head having a diameter of 2 mm, at the center of the femoral attachment of the AM mid-substance fibers.
Pin in place, remove the marker pin and then slip stitch in place, attaching all of the handle.
Position the handle so that the moss stitch border is on the handle just below the moss stitch border on the bag, in line with the marker pin.
Setting out on a long journey, I half expect to see the marker pins of a Google map rearing above the highway like giant hat pins, shadowing the pavement ahead.
A green arrow appears on the map — it may pop up behind any red marker pins in the area and be hard to see, but you can zoom in closer for better visibility.
An elaborate custom-built suitcase is provided to ZOPPs with markers, pins, glue-sticks, varied colored shapes and sizes of paper strips.
mRNA transcripts for the stress protein markers Pin-II and protein P4 were isolated from the 4th leaf of 30-cm plants and assayed by real-time RT PCR as described [ 21], using the following sense and antisense DNA primers: 5′ GCGAAGGCTTGCACTTTAGAATGTG 3′ and 5′ GGACAAGTCTAGGGTCACATTGCAGGGTAC 3′ for Pin-II; and 5'–CTCandTGTCTCATGGTATTAGCC–3′ and 5′ CAGGATCATAGTTGCATGAAATG 3' for protein P4.
Then, walk round the model using the marker to pin up the hem, placing pins parallel to the hem at close intervals.
Quantitative RT-PCR gene expression analysis in susceptible and resistant tomato plants infected with R. solanacearum revealed little or no activation of the jasmonic acid (JA) pathway marker genes Pin-2 and LoxA [18], [19].
In the molecular aspects, several genetic alteration such as glutathione S-transferase pi 1 (GSTP1), NKX3.1, p27 and PTEN have been regarded as the markers of PIN and PCa (Wagenlehner et al, 2007).
A passive retro-reflective cluster with three or four markers was pinned directly into the each of the bones of interest (humerus, clavicle, scapula and thorax (sternum)).
