Sentence examples for mark the mutated from inspiring English sources

Red rectangles mark the mutated residues.

The three-dimensional structure of the protein (when available) marking the mutated position is also shown.

As the insertion mutations are all marked with the mutated loxP sequence, lox71, introducing a plasmid bearing the lox66 sequence into cells expressing Cre recombinase should allow stable integration of the lox66 plasmid into the lox71 sequence.

The target of the mutated siFIP200#1 is CTGGGACGGATACAAATCCAA; and the target of mutated siFIP200 2, ACGCAAGTCCGTTGATGATTA.

However, western blot analysis of the mutated Siz1 proteins marked with a 9myc-epitope revealed strongly reduced signals for SAP* and in particular for SAPΔ in total cell extracts, implying that the lack of activity towards PCNA in vivo might be due to insufficient protein rather than ineffective nuclear localisation or defective DNA binding.

The mutated target luciferase reporter bearing single-nucleotide or two-nucleotide mutated target sequences were obtained by the same approach.

None of the mutated constructs showed a marked reduction or even absence of pTRY-A3, B GUS expression.

In the present study on the function of rat P2X2 receptors with cysteine substitutions in the pre-TM2 region, we observed marked differences in the apparent molecular mass of the mutated receptors when expressed in HEK (human embryonic kidney -293 cells.

The mutated double lashes!

They both had the mutated cells in their blood.

With the mutated gene, people break down triglycerides unusually quickly.