Sentence examples for mark name from inspiring English sources
Its last five hotels were sold early this year, and, of those, currently only two — in Buffalo and Indianapolis — still carry the Adam's Mark name.
All major construction or renovation projects should include an appropriate contingency budget for plaques that will mark named spaces.
As long as the Nets tolerate the question mark named Micheal Ray Richardson, the team will suffer from the uncertainty of what might happen tomorrow.
Mixed in with this dodgy crowd is a question mark named Martine, a pulpy femme fatale who's been sensitively shaded in by Saffron Burrows.
She has already made her mark, naming eight new caps in her squad.
Table 1 KASP SNP markers for specific gene target used for MABC for improving KDML105 Traits Marker Name Chr.
Table 1 Description of expression marks Name Definition agitato Agitated amabile Amiable, pleasant appassionato Passionately capriccioso Unpredictable, volatile grazioso Gracefully lamentoso Lamenting, mournfully leggiero Lightly, delicately maestoso Majestically pesante Heavy, ponderous soave Softly spiritoso Spiritedly tranquillo Calmly, peacefully.
The percentage of alleles called for each locus and average coverage are reported in Table 1.> -wrap-foot> Marker name, total call rate, and average read depth.
Major histocompatibility complex (MHC) class Ia, which plays an important role in the immune system, was previously sequenced from Japanese flounder (AB490772) and a microsatellite was identified in that region (Marker name: JFMHC1, Forward primer: GGCCTGGATAATGTGGACAC, Reverse primer: GAGTGTTGGGCCTTGGTG).
In the box marked "Name," type in the resource's name.
