Sentence examples for maps indicated by from inspiring English sources

Exact(4)

where p1,...,p M is the set of neighbours of the considered point, w1,..., w M are the weights and s labels each of the 3 N-2) pairs of maps (indicated by ij in Equation 5).

The phase movie in middle temporal cortex reveals the presence of additional well-defined retinotopic maps (indicated by white outlines in the first frame of the movie in Fig. 3 B ).

However, when treated as a rigid body, the crystal structure clearly does not fit into the cryo-EM density maps, indicated by a correlation coefficient as low as 0.55.

Including the markers already available (SNPs, simple sequence repeats (SSRs) and EST-Ps), we eventually mapped a total of 550 and 619 markers on the G2F and G2M maps, respectively, 25 of these loci being common to both maps (indicated by dashed green lines in Figure  2 and Additional file 3).

Similar(56)

The location of the station is shown on the map (indicated by a rectangle in each panel).

Projection difference maps indicated helix movements by about 2 Å in the 6-helix bundle region of MjNhaP1 that is thought to contain the ion translocation site.

A forward primer in Intron 10 (gtgttggcaaggattctgagacc, nt 187617-187639, GenbAF5338923892) and a reverse primer located in the targeting vector pTV12E60 (cloning vector pIRES1neo, Genbank U89673.1) (ggaagacaatagcaggcatgct, nt 2672-3128) yields a 410 bp product which maps as indicated by the red line in Figure 1a.

The same pattern of gene expression is clearly visible in both the barley and wheat heat maps indicating that, by and large, gene expression in the two species is highly conserved.

The low resolution of the bovine linkage map is indicated by multiple markers sharing the same map position, even when they may be separated by a substantial physical distance.

Figure 4 Raman spectra of the pattern-in and pattern-out area Figure 5 a Optical image of the 2D mapping area, indicated by the square and b image of the 2D Raman intensity mapping.

The area of interest on the map is indicated by a red rectangle.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: