Sentence examples for maps as indicated from inspiring English sources

Several local flood-prone areas were identified from the maps, as indicated in the hazard maps of the 100-year recurrence interval.

A forward primer in Intron 10 (gtgttggcaaggattctgagacc, nt 187617-187639, GenbAF5338923892) and a reverse primer located in the targeting vector pTV12E60 (cloning vector pIRES1neo, Genbank U89673.1) (ggaagacaatagcaggcatgct, nt 2672-3128) yields a 410 bp product which maps as indicated by the red line in Figure 1a.

where s = [ b 1 b 2 … b ℓ map ] is labeling pattern and ψ is the mapping function as indicated in Figure 1.

This is computed based on the spectral efficiency per user, using the mapping function as indicated in [21], where the block error rate (BLER) (text {BLER}=1-exp left (text {log}frac { 1-text { 1-text{BLER}{TBS}{textt)), should be smaller or equal to 10%, and the transport block size (TBS) for the estimated CQI is calculated as reported in [21].

Instead of simply showing a static map, or noting the aisle number where a product can be found, the new Target application will actually show your own location on the map, as indicated by a blinking dot.

Additional flow information is clearly visible in this Doppler map as indicated by the white arrow in Fig. 7(c).

We compared the SfiI restriction sites between our draft and the experimental physical map as indicated in Figure 3.

(C ) Immunofluorescence images of same cell lines as in B. CENP-A intensity is represented in a heat map as indicated on the right.

Notice that more than one sub-solution may refer to a same mapping as indicated in Figure 3, thus leading to a DAG structure when the set of all solutions is considered and representing a compact structure for containing them all.

Left, view rotated from the guide map (inset) as indicated.

MISCORE is found to have convincing recognizability performances that are comparable to IC and remarkably better than MAP score as indicated in the result summary.