Sentence examples for mapped to isolated from inspiring English sources

Only four of these 17 genes have been mapped to linkage groups, whereas the remaining 13 were just mapped to isolated scaffolds.

The YGL138 t) locus was mapped to chromosome 11 and isolated into a confined region of 91.8 kb by map-based cloning.

Figure 2 shows a ML tree based on SNP analysis of 44 S. Heidelberg isolates mapped to strain SL476.

Cerro isolates mapped to 86, 88, and 90% of the coding sequences in S. Typhi CT18, S. Typhimurium LT2, and S. Choleraesuis SC-B67, respectively.

All sequence reads generated from the two libraries were mapped to a reference genome (isolate F/SW4 GenBank accession NC_017951.1) and the proportions of sequence reads mapping calculated.

To this end, small RNA (sRNA) populations were isolated and mapped to the genome.

The exceptions, CATGCACGCTTTTTAATTACA and CATGTGTATGTATTAAAAATA, mapped to a single human EST isolated from a uterine tumour (EST BF909200).

The human genome[ 1] was assembled using a hierarchical approach, where bacterial artificial chromosomes (BACs) were isolated and mapped to the genome and then individually sequenced.

Of the 13 mutations isolated, 4 mapped to known components of the dosage compensation complex demonstrating the specificity of the screen design.

A total of 38 V. cholerae O1 El Tor biotype (22 from flood-affected and 16 from non flood-affected regionon flood-affectedand mapped to locations acregionskistan.

In 1994, a transposon mutant (llm) that suppressed methicillin resistance in S. aureus was isolated and mapped to the 3′-terminal region of tarO, which encodes the first step of WTA synthesis.