Your English writing platform
Discover LudwigSuggestions(5)
Exact(7)
To complete the physical map, an additional whole genome BAC library was developed from Hope, and screened with markers flanking the gaps.
Using this genetic/physical synteny, we have also been able to electronically map an additional 20,000 common bean EST contigs and singletons relative to soybean.
In each case, we were able to map an additional approximately four million reads (~6.5% of the original set of sequenced reads).
This allows up to map an additional 253 scaffolds representing 4% of the assembled genome, bringing the complete map coverage to 729 scaffolds covering 79% of the assembled genome.
By reducing our stringency on which tags are deemed ambiguous we can successfully map an additional 3 genes of our top ten genes to the top 15 most abundant genes in the SAGE library.
To enrich the map, an additional SCAR marker ("Ind10-20"), designed and run as previously described [ 11], was targeted to the LepR3 locus (Bra008890) using the following primers; F - TTCGTGATGAGTTTGCGGTTC, R -CAGTCGCTGTTATTCACCCATGA.
Similar(53)
In the existence and uniqueness proofs of fixed points of α-admissible maps, an additional property is required.
We also mapped an additional nine events solely by SNP arrays.
We have also mapped an additional six BES microsatellites onto linkage groups of the INRA genetic map (Additional file 1, sheet 1).
Further mapping an additional 55 offspring places male sterility in a gene-dense, 338-kb region of chromosome 4.
We mapped an additional 80 BACs, extending the set to 125 markers on macrochromosomes and 42 on microchromosomes.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com