Sentence examples for manually to identify from inspiring English sources

Issues of The International Journal of Prosthodontics, The Journal of Prosthetic Dentistry, and The Journal of Prosthodontics published between 1988 and 1997 were searched manually to identify RCTs.

Targeted region of the DOCS1 gene has been amplified by PCR with the Phusion TaqPolymerase (Thermo Scientific) and the following primers: AAAAAGCAGGCTTGGGGGACCCGCCGCTGTCG and TAACAAAATCCCACGAACGAATCAG. PCR products were sequenced and chromatograms were analyzed manually to identify mutations.

The superimposed structures were compared manually to identify differences (structural features) that could be incorporated into our modelling workflow assessment.

All these information were assembled and analyzed manually to identify candidate metabolic functions.

DNA sequence data was examined manually to identify polymorphisms that overlapped with the 25-mer probes.

Genotype calls were then reviewed manually to identify any uncertain calls due to clustering artifacts.

For gaps with identical flanking sequences, insert size for mate-pair reads and signal pattern for optical molecules that span or flank these gaps were manually inspected, to identify redundant sequences that were then trimmed to close the gaps.

The remaining terms were manually screened to identify 500 terms describing anatomy, hardware/software types and vendors, applications, and printing materials.

Results were manually curated to identify novel glycosylation-related transcripts in bovine milk.

The di- and tri-phosphorylated peptide sequences were manually aligned to identify any motifs represented in the di- and tri-phosphorylated phospho-peptides in our dataset.

References were also manually searched to identify other sources.