Sentence examples for manually selected using from inspiring English sources

Subsequently, the region of central brain was manually selected (using free-hand function) and absolute fluorescence intensity was measured and normalized to the area of the central brain for each brain.

Bands were manually selected using the volume tool.

Particles were manually selected using Samviewer (Liao et al., 2013).

The control point and its coordinates were manually selected using the CAD system.

Bands manually selected using the agarose method can often lead to a poor map [ 17, 18].

Single particles were manually selected using boxer (Ludtke et al., 1999).

Volumes of interest (VOIs) were either manually drawn or semi-automatically selected using the "levelset VOI" tool in MIPAV.

Endo- and epicardial contours were manually traced, and the remote myocardium was selected using a region of interest.

Intensity measurements were taken from manually selected puncta using 1 µm ROIs.

Colonies were manually selected, sequenced using CYBB-specific PCR primers gp91forward1 and gp91reverse2 (CAGGAAGTTGCAATGGAGGGA), and converted to growth on Matrigel in mTeSR1.

Although we ran a pilot study beforehand, our participants were all manually selected and used a PC to access and complete it.