Sentence examples for manually extracted the from inspiring English sources

We manually extracted the initial matching points and used an extraction algorithm in the 9-pixel neighborhood of the initial points with subpixel accuracy to extract the matching points.

We manually extracted the initial matching points and then used an extraction algorithm with subpixel accuracy in a 9-pixel neighborhood of the initial points to extract matching points.

By categorizing studies based on similar diseases, we manually extracted the disease Medical Subject Heading (MESH) terms [9], and mapped them to the Concept Unique Identifiers (CUI) in the Unified Medical Language System ULMSS) [10] to standardize disease names.

Since the genes identified by these methods (as being differentially expressed) did not necessarily have expression ratios at all the time points (some were filtered out at one stage, but were retained at another) we manually extracted the adjusted intensity values at these time points and calculated the ratios from the corresponding hybridization data.

We manually extracted the interactions between these 11 RTKs and 21 SH2 domains from literature.

In order to examine the difference we manually extracted the TACs from the carotid artery.

Then we manually extract the state-of-the-art texture descriptors named median robust extended local binary patterns (MRELBP) from spectrograms.

It would be very difficult if not impossible to manually extract the associations between the concepts (which do not appear in the same document), to infer potentially new hypotheses, especially with the large amount of available concepts and literature.

In can be inferred qualitatively that the PPF achieves better results than the standard particle filter.

An average steady-state value was calculated for each test by manually extracting the metabolic steady-state data and averaging the corresponding values.

Individual spacers were removed from the sequences by manually extracting the sequence between the repeats sequences: A repeat is GATAATCTACTATAGAATTGAAAG and C repeat is GATTAATCCTAAAAGGAATTGAAAG. Spacers were grouped according to the ends of the loci they came from, and BLASTn [48] with E<0.001 was used to find 100% spacer matches.