Suggestions(1)
Exact(2)
The elements of such strategies are: * demand management, which focuses on reducing excessive demand; * incident management, which targets resources to alleviate accident hot spots; * traveler information, which potentially reduces traveler buffer time; * traffic control, which implements aggressive ramp metering at locations where significant reductions in congestion are likely to occur.
Since the prevalence of obesity in the US is increasing among most demographic subgroups [ 4], therapeutic management which targets obese hypertensive patients is critical to successful BP control.
Similar(58)
Within the current study, the personalised care approach is more broadly focused than case management which typically exclusively targets the most complex and vulnerable patients; and is delivered by means of regular telephone contacts.
This announcement marked a change of heart for Target management, which has long maintained the company's commitment to owning its credit business, Augustine said.
The most reported outcomes in the included reviews and the reported effectiveness of the self-management support interventions are shown in Additional file 7. Four reviews [ 16, 18, 19, 22] described self-management support interventions which target a supportive relationship between the person with dementia and the informal caregiver.
In this section, the modified JPDA is enhanced by incorporating the probability of target existence as a track quality measure for track management, which utilizes the probability of target existence to confirm or terminate tracks, and is termed as modified joint integrated probabilistic data association (MJIPDA).
Niecza, which targets the Common Language Runtime.
TAS2 produces TATTCGAGTATATGCAAAAGA, which targets just TAS1A.
Mr. Ackman's critics argue the proxy fight has been a distraction to Target's management, which should be focused on running its business and improving its stores.
The message from this study is that targets and performance management, which all four countries use, work.
The mechanism by which targeted temperature management works is complex and still not fully understood.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com