Sentence examples for make the fragments from inspiring English sources

But rather than simply drying an existing vaccine, he wants to splice into the subtilis bacterium's DNA the ability to make the fragments of viral protein that provoke the immune reaction.

Knowing that they could easily be overlooked in a flashier show, she decided to make the fragments the focal points instead of also-rans.

Another good trick for meteorite-hunters is to attach an extremely strong magnet to a walking stick because the iron and nickel found in most meteorites make the fragments magnetic.

To make the fragments visible, the samples were mixed with antidigoxigenin-AP Fab fragments (Roche) and then nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indol-phospate (NBT/BCIP) Stock Solution (Roche) according to the manufacturer's instructions.

However, as will be described in the next section, we need to take further steps to make the fragment chaining solution efficient and its results close to those implied by nucleotide-level formulation towards a practical solution.

The structure made the fragments possible to be ligated with adapters and performed PCR amplification.

Since the average length of a bacterial gene is ~ 1.1 kb, the size distribution of the C. saccharolyticus DNA fragments should cover most of the single genes as well as some operons, making the fragments an excellent pool of substrates for transformation.

In addition, oxygen-containing groups make the aromatic fragments very polar; therefore, the depolymerized coal samples obtained at pH = 1.99 4.09 can be well dissolved in polar solvents such as DMSO, DMF and acetone, but cannot be dissolved in low polarity solvents such as CHCl3.

After obtaining a pair of real or simulated haplotypes, in order to make the generated fragments have the same statistical features as the real data, a widely used shotgun assembly simulator Celsim (Myers, 1999 is invoked to generate m fragments whose lengths are between lMin and lMax.

I find blockchain-level native identity a worthy proposition because if there's no native identity, the teams that are solving the identity problem will make the ecosystem fragmented.

In order to make the SASI fragment design applicable to Nextera library preparation and PCR-based enrichment approaches, we added the sequences TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, that are normally introduced via the Nextera reaction [ 33], to the respective 5' ends of forward and reverse primers used in SASI fragment generation.