Point mutation of the L. major active site aspartate to alanine was performed by PCR using the QuickChange Site-Directed mutagenesis kit (Stratagene) using the forward and reverse primers AAAGCCTTCGTCGCGTCCGGCGCGCAG and CTGCGCCGGACGCGACGAAGGCTTTC.
More accurate determination of TSS usage, e.g. using approaches such as cap analysis of gene expression (CAGE) together with H3K4me3 enrichment data may improve the usefulness of this histone modification in predicting major active start sites among closely located TSSs.
This hydrogen bond would probably constrain the structure of the hairpin loop and the β-sheet adjacent to the major MgATPase active site in NBD2.
The two-site model satisfactorily explains the major part of the active sites of this highly isospecific catalyst and is a suitable tool for analysing the effects of the donors on catalyst active sites.
To spatially reconstruct the two major cyclization pathways in TEAS, we manually docked transition state structures and models of the major products into the respective active sites of wild-type trans-2F-FPP and cis-2F-FPP complexes (5, panel a).
Furthermore, temperature changes within the mesophilic range (10 to 40°C) do not result in major structural alterations of the active sites of enzymes from mesophilic microorganisms [ 26, 27].
In order to investigate whether active sites of major enzyme motifs were conserved, dinoflagellate sequences from NCBI were aligned with reference sequences from A. ostenfeldii, A. spinosum, H. triquetra, and K. brevis.
In this review, we have highlighted recent major achievements regarding elucidation of the active sites in MoSx-based electrocatalysts for the HER, and summarized synthetic strategies for designing MoSx electrocatalysts with enhanced HER activities.
Overall, eight experimental ligands and glucantime were docked using AutoDock 4.3 program into the active sites of Leishmania major and Leishmania infantum pteridine reductase 1, which were modeled using homology modeling programs.
No major deviations were observed between the active sites of the mutant ternary complex and wild-type KlenTaq1 ternary complex in the closed conformation.
