Sentence examples for made using forward from inspiring English sources

Identification of significant covariates for each outcome variable was made using forward stepwise regression models.

A 559-bp Bcl2l1 probe was made using the forward primer (FP) TGGTCGACTTTCTCTCCTAC and reverse primer (RP) AGAGATCCACAAAAGTGTCC.

A translation of the instrument into Swedish has been made, using both forward- and backward translation.

Detection of all CPV types was made using conserved forward and reverse primers that amplified a 461 bp product that encapsidates the 426 amino acid residue.

Amplification of cDNA from bacterial culture medium (0.5 μl) was made using M13 forward-20 / M13 reverse (Qiagen PCR cloning kit, Qiagen, Courtaboeuf, France) with 1 mM MgCl2.

As a result of this limitation, classification searches on sequence data must be made using each input sequence's forward and reverse-complement effectively doubling the number of classification searches required.

No "last observation carried forward" was made using data from the prepregnancy period.

Physical length estimates of introgressions flanked by SSR markers were made using the location of the forward primers, SNP locations were determined by their location in the Col-0 reference genome.

You'll need to forward any reservations made using your work email to your Gmail account if you want those to show up.

Inserted donor fragments were screened by gel analysis of PCR amplicons made using primers that flanked the MCS; forward (5'-3'): AGT TCT GCA CTC GGC CTC TG, and reverse (5'-3'): CCA TGG TCT GCA GTC GCT AG.

Consensus sequences of forward and reverse sequences were made using the Geneious (Biomatters, Ltd).