Sentence examples for made by digesting from inspiring English sources
dsDNA was made by digesting calf thymus DNA with S1 nuclease [ 22].
The ADH1pr-HTB2-CFP construct was made by digesting pCT2006 with XbaI and integrating at the TRP1 locus.
The WHI5-tdTomato constructs were made by digesting pCT2001 with HindIII, integrating at the WHI5 locus and losing the CaURA3 marker between the two TEF1 terminators.
FLAG MSL1CT constructs were made by digesting the appropriate PCR fragments by BglII and XhoI, then cloning into BglII XhoI double digested pUAST FLAG vector.
The inducible CLN3 constructs were made by digesting pCT2002, pCT2003, pCT2004, or pCT2005 with PmeI and integrating at the HIS3 locus.
mCherry-vinculin 1-881 and mCherry-vinculin 1-258 were made by digesting the PCR product of truncated mCh-vinculin with AgeI and KpnI and ligating it into the pEGFP-C1 vector.
The BD GenomeWalker™ Universal Kit (Clontech) was used to make four libraries by digesting the high molecular weight DNA with DraI, EcoRV, PvuII, and StuI, followed by DNA purification, and ligation of genomic DNA to BD GenomeWalker™ adaptors according to the manufacturer's instructions.
Most of the cholesterol circulating in your blood has been made by your liver, not digested from the food you eat.
Stocks were up from early morning as investors digested comments made by European Central Bank Chief Economist Otmar Issing concerning inflationary pressures and rising interest rates in Europe.
Phya without the downstream GATEWAY tag was amplify with primer pair Pa-SacF (CTCGAATTCCTTCTCTTTTACTCGTTTAG) and Pa-HindR (TGAGGAAGCTTATCGATGGTACCGCGGCATGCATATGGCACGTCTCTCCTCCTTGCG), the pET-A plasmid was made by inserting the HindIII/EcoRI digested PCR product into the similarly treated pETDuet-1(Novagen).
pKai51.2-PH1light-scFv, containing the light chain PH1-scFv PH1, was made by cloning the EcoRV/SpeI digested amplification fragment from pES31-PH1light-scFv_zeo with primers NM266 and NM937.
