Sentence examples for made by amplifying from inspiring English sources

The INA-1ECD::GFP plasmid was made by amplifying a DNA fragment from the pACT C. elegans cDNA library40 using the oligonucleotides 5′-CTCGAGATGCGTGAATGTATAATTAGCTGGAC-3′ and 5′-GGATCCCCGATAGGTCGAGAGTCTCCAATTGT-3′, and then inserted into the pEGFP-N1 vector (Clonetech).

The TTR-11::FLAG and TTR-11(N46A)::FLAG plasmids for the expression in mammalian cells were made by amplifying a DNA fragment from synthesized ttr-11 cDNA or ttr-11(N46A) cDNA using the oligonucleotides 5′-GGTACCGCTAGCATGAACGCGACAATTTTTCTCGTGG-3′ and 5′-GGTACCGTTTCGTGGAGGTCGAAGGTCAC-3′, and inserted into the pCMV- DYKDDDDK -C vector (Clonetech).

The NDRG1 DsRed2 fusion vector was made by amplifying NDRG1 from the prostate cDNA library and cloning it in-frame with the DsRed2 protein.

Pexp-1 gfp Pexp-1 gfp amplifying a 3.5 kb EcoRV–EcoRV fragment from the exp-1 promoter wash primade containing an upstream PstI site and a downstream bymHI site.

Punc-47::dsred was made by amplifying a 1.4 kb promoter region upstream of the start codon with primers containing an upstream HindIII site and a downstream KpnI site.

Plasmids for colocalization purposes were made by amplifying mCherry from the vector pCFJ90 (Addgene plasmid 19327; [15]) and cloning the sequence upstream of the start codon of either rab-5 or unc-108 cDNA.

Plasmid pECV was made by first amplifying a LacZ fragment by PCR from pUC19 using primers ecv1 (ttt gaagacttgtcgggtctcaaggtgcagctggcacgacaggtttc) and ecv2 (ttt gaagactttaccggtctcaaagccgcgcgtttcggtgatgac).

Recombinant Bak constructs were made by PCR amplifying Bak ORF (Origene) and ligating into fluorophore-tagged vectors.

When Trump, at the launch of his campaign, mentioned Mexican "rapists," he was amplifying a claim made by Ann Coulter, the pundit and provocateur.

In the interview, Mr. Putin also warned that Russia would develop and deploy new nuclear weapons if the United States did not accept its proposals on integrating Russian and European missile defense forces — amplifying a comment made by Mr. Medvedev in his annual state of the nation address on Tuesday.

By Tom O'Reilly The New Yorker, November 9, 1940 P. 88 As usual, all anouncements at the National are to be made by Otis Trowbridge, of Pelham Manor, an electrical engineer, who has been supplying Nationals with amplifying equipment, and announcing events at them for eight years.