Sentence examples for lower strand from inspiring English sources

Two DNA primers were designed and utilized as follows: upper strand primer: 5' GTGTTCandGGCCGCTCCGGGCTATGAAATAGAAAAATGAATCCGTTGCCTGCGTTATC3', and lower strand primer: 5'CAGGATGGCGGCCGCCCATCTGGTATCACTTAAAGGTATTAAAAACCCCACAGATGCG3', which were synthesized by Shanghai Sangon Co. Ltd.

The HSVd-sRNAs hotspot (HS3) mapped to the lower strand of the viroid rod-like secondary structure, partially overlapping with HS2 (Fig. 5A).

The sequences for the LEF1 qPCR primers: Upper strand: 5'-TATGATTCCCGGTCCTCCTGGTC-3'; Lower strand: 5'-TGGCTCCTGCTCCTTTCTCTGTTC-3' For immunoprecipitations, cells were harvested by centrifugation and washed one time with DPBS on ice.

Palindromic sites can occur on both, the upper and lower strand (relative orientation, Figure 2).

Orientation of the motif is indicated on the right (+, upper strand; −, lower strand).

To distinguish the parental origin after bisulfite conversion, we amplified and sequenced the lower strand (G > A).

These studies show that the folding of artificial β-sheets 6 is cooperative, with the interactions between the upper and middle strands and between the middle and lower strands reinforcing each other.

In the rod-like secondary structure proposed for HSVd, sRNAs hotspots (HS1 and HS2) mapped to the upper and lower strands, partially covering the central and the variable domains (Fig. 5A).

The upper and lower strands were mixed at equimolar concentrations, heated to 95° C, and then annealed by gradual cooling to room temperature to form double-stranded promoter fragments, with each fragment having specific 3-base overhangs that corresponded to its particular insertion region (Upstream, Core, Downstream) and allowed for ordered ligation.

For the final identification of real genetic variation with low-level somatic mosaicism, we determined that both of the P-values for the ith residue in the upper and lower strands must be smaller than the threshold.

Second, the end-polishing step was omitted, and modified A and B adapters were used as follows: adapter A-upper strand: 5'-CCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAGT-3', adapter A-lower strand: 5'-CTGAGACAGGGAGGGAACAGATGG-3', adapter B-upper strand: 5'-BIO-TEG-CCTATCCCCTGTGTGCCTTGCCTATCCCCTGTTGCGTGTCTCAGT-3' and adapter B-lower strand: 5'-P-CTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG-3'.