The location of transposition events in the smaller MluI/XmaI fragment (in or near the repeat) was determined by DNA sequencing using primer N (5' ACTTTATTGTCATAGTTTAGATCTATTTTG 3') and primer S (5' ATAATCCTTAAAAACTCCATTTCCACCCCT 3') of the GPS system.
The location of transposition events in the smaller MluI/XmaI fragment (in or near the repeat) was determined by DNA sequencing using primers Kan2-FP-1 (5' ACCTACAACAAAGCTCTCATCAACC 3') and Kan2-RP-1 (5' GCAATGTAACATCAGAGATTTTGAG 3') of the EZ-TN system.
The scale space comprised tasks in which the ape had to either locate a reward (spatial memory), track a reward after invisible displacement (object permanence), after a rotation manipulation (rotation) or after location changes (transposition).
If there are four locations and four facilities, the transposition of facility location in 2-opt method is like that in Figure 4.
For example, if there are three facilities in the same location, two types of transposition can be used with the 3-opt algorithm.
Their extragenic location would warrant that transposition did not disrupt genes.
However, TEs containing one or more cis-regulatory elements can move to a new location by a single transposition and thereby add new regulatory functions to the targeted gene, speeding up a process that could have required million years of evolution without the TE.
This figure illustrates that for the first transposition, the facility in location one can be changed with the facility in location two, and for the second transposition, the facility in location one can be changed with the facility in location three, so that if the number of location and facility is shown by n, the number of transposition in each iteration will be n(n − 1)/2.
Depending upon the orientation of the termini and on the chromosomal location of the elements, alternative transpositions can lead to many kinds of chromosomal rearrangements including inversions, duplications, and deletions [ 4].
